Immunostimulation na truta de arco-íris (mykiss de Oncorhynchus) administração de intraperitoneal seguinte de Ergosan

Immunostimulation na truta de arco-íris (mykiss de Oncorhynchus) administração de...

Immunostimulation in the rainbow trout (Oncorhynchus mykiss)

following intraperitoneal administration of Ergosan

Scott Peddie, Jun Zou, Christopher J. Secombes*

Department of Zoology, University of Aberdeen, Tillydrone Avenue, Aberdeen, AB24 2TZ Scotland, UK

Received 5 September 2001; received in revised form 28 January 2002; accepted 28 January 2002

Immunostimulation na truta de arco-íris (mykiss de Oncorhynchus) administração de intraperitoneal seguinte de Ergosan.

O trabalho presente provê informação relativo à atividade de immunostimulatory de Ergosan, um algal fundou produto, intraperitoneally injetado na truta de arco-íris (mykiss de Oncorhynchus). Ergosan está composto de 0.002% extrato de planta não especificado, 1% ácido de alginic de digitata de Laminaria, e 98.998% algal fundaram o portador. Migração de leucocytes na cavidade de peritoneal era estimulado a doses 1 ml1 de mg. UMA única dose de 1 mg aumentou a proporção de neutrophils significativamente, grau de phagocytosis, atividade de estouro respiratória e expressão de interleukin-1b (IL-1b), interleukin-8 (IL-8) e um dos dois conhecido isoforms de necrose de tumor de truta fator-um (TNF2) em leucocytes de peritoneal a 1 poste-injeção de dia. Humoral parâmetros imunes era menos responsivo a intraperitoneal administração de Ergosan, com excitação de complemento só evidente no 1 mg tratado se agrupe a 2 poste-injeção de dias. Antiprotease e atividade de lysozyme eram não afetadas por Ergosan em cima de um período de tempo de 7-dia ao doses examinaram. #2002 Ciência de Elsevier B.V. todos os direitos reservados.

1. Introdução

Ácido de Alginic é derivado de vários gêneros de algas marrons inclusive Macrocystis, Laminaria, Lessonia, Ascophyllum, Alaria, Ecklonia, Eisenia, Neroecystis, Sargassum, Cystoseira e Fucus. Embora Ergosan contém 1% ácido de alginic extraído de Digitata de Laminaria, a maioria do alginates do mundo, é extraído de pyrifera de Macrocystis e Nodosum de Ascophyllum (o Lewis al de et., 1990). Algin é distribuído ao longo da mucilagem de intercellular e paredes de cela das espécies de algal acima mencionado (Chapman e Chapman, 1980) e é extraído de ou fresco ou secou material. No alginate típico processo industrial, sais de alginate insolúveis são convertido a uma forma solúvel de alginate de sódio dentro a presença de um álcali. Diluição subseqüente do mistura com degradação de causas de água fresca de cela estruture com a liberação de resultante do sódio alginate em solução. As partículas de algal insolúveis são separado da solução de alginate de sódio através de centrifugation, ainda o alginate é colhido por uma gama de técnicas, como precipitação com cálcio, cloreto, eletrólise ou dirige secando. O passo final em o processo envolve neutralisation de ácido de alginic com um cation apropriado funda, enquanto secando e moendo produza o produto de fim em forma pulverizada (Ertsva°g e Valla, 1998). Ácido de Alginic é um polysaccharide composto de dois formas de ácido de uronic: ácido de mannuronic e guluronic que forma três tipos de polímero ‘bloqueia'. As diferenças no mannuronic/guluronic relação ácida é responsável para a diversidade de propriedades de alginate / função e pode variar de acordo com espécies de alga usado, local de colheita e estação de colheita (Ertsva°g e Valla, 1998). Estas propriedades variáveis têm conduza a algines que é utilizado para uma gama de comercial aplicações incluindo engrossando os agentes, gelling, os agentes e estabilizadores de dispersão (Ertsva°g e Valla, 1998).

Extratos de vários macrophytes marinho produza antibacteriano, antifungal, antivirótico, cytotoxic, antitumour e antimitotic compõe (Ballesteros al de et., 1992; Cannell, 1993,; Hudson et al., 1998; Okai al de et., 1994; Hudson et al., 1999; Serkedjieva et al., 2000). semelhantemente, microalgae, especialmente o cyanobacteria, produza antivirótico, antineoplastic e bactericida combinações (Borowitza, 1995,; Schaeffer e Krylov, 2000). Além disso, pathogens de peixe, incluindo, as bactérias anguillarum de Vibrio e o causativo agente de Haemorrhagic Septicaemia Virótico (VHSV), é inibido diretamente através de extratos de microalgal (Fabregas al de et., 1999; Austin e Dia, 1990,; Austin et al., 1992).

No modelo mamífero, alginates e ácido de alginic tenha numeroso efeitos incluindo biológico aumentado excreção de colesterol e tolerância de glicose (Kimura al de et., 1996), inibição de proliferação de cela de músculo lisa (Logeart et al., 1997a,b), fibroblast supresso proliferação e síntese de colágeno em pele humana (Tajima et al., 1999), inibição de liberação de histamine de celas de mastro (Asada et al., 1997) e excitação de growth/migration de cela de endothelial (Kawada et al., 1999). também foram investigadas matrizes de Alginate para uso como sistemas de entrapment/delivery para biológico agentes, inclusive antígenos (Gombotz e Urina, 1998). Com respeito a propriedades de immunomodulatory, Laminaria extrato de japonica estimula atividade de murine celas de phagocytic, expressão de IL-1a e TNF, como bem, como produção aumentada dos anticorpos de polyclonal IgM e IgG no baço (Okai et al., 1996).

No modelo de piscine, extratos de Laminaria propagação aumentada hiperbórea, pinocytosis, intracellular, produção de anionte de superoxide e ácido atividade de phosphatase em salmão (salar de Salmo) cabeça macrofagócito de rim (Dalmo e Seljelid, 1995). Em carpa (carpio de Cyprinus o L.), alginate de sódio aumenta a migração de phagocytes de rim de cabeça para o local de injeção, ainda concomitantly que aumenta o deles/delas atividade de phagocytic. Além disso, alginate de sódio estimula leucocytes de peritoneal para produzir chemotactic fatores, além de aumentar a sensibilidade, de phagocytes de rim de cabeça para tal fatora (Fujiki e Yano, 1997). Com referência específica para Ergosan, Milhas al de et. (2001) demonstrou isso Snakehead Listrado (Striata de Channa) injetou intraperitoneally com 0.5 mg Ergosan, suspenso em PBS, resultou em immunostimulation. Soro e macrofagócito de tratou peixes demonstraram inhibitory significante efetua no germinação e crescimento subseqüente de Aphanomyces invadans (¼piscicida), o agente causativo de epizootic síndrome de ulcerative, a 14 poste-injeção de dias.

A pontaria desta investigação é caracterizar localizado e immunostimulation sistêmico no arco-íris truta (mykiss de Oncorhynchus), intraperitoneal seguinte administração de Ergosan a uma gama de doses.

2. Materiais e métodos

2.1. manutenção de peixe

Truta de arco-íris (mykiss de O.) pesando 100–500 g foi obtido de Almondbank (Perthshire, REINO UNIDO) e proveu em 250 l abastece, manteve às 12 1 8C, com um fluxo constante de arejou e dechlorinated mains molham. Foram alimentados peixes ad libitum diário com pelotas comerciais (Ewos). Um período de aclimação de 2 semanas foi observado antes das experiências começando.

2.2. preparação de suspensões de Ergosan

Ergosan, obtido de Vacinas de Aquaculture Limitadas, (Açafrão Waldon, REINO UNIDO) está composto de 0.002% extrato de planta não especificado, 1% ácido de alginic de Laminaria, digitata, e 98.998% algal fundaram o portador. Provido em forma pulverizada, Ergosan estava suspenso ao concentração apropriada em 0.15 fosfato de M estéril buffered pH 7.2 salino (PBS, Gibco), e sonicated em gelo para 30 min.

2.3. localizou cela de peritoneal de effects—direct conta / contas de leucocyte de diferencial

Seis grupos de cinco pescam (100 g) era anaesthetised com benzocaine (etilo-4-aminobenzoate, BDH) solução (4 ml1 de mg de ethanol) diluiu em água. Cada peixe foi injetado intraperitoneally com 250 ml de ou PBS (controle) ou 0.01, 0.1, 1, 5 e 10 ml1 de mg Ergosan. A 1 poste-injeção de dia, peritoneal celas eram usando isolados o método descrito por Secombes (1990). Brevemente, matou pesca foi injetado intraperitoneally com 5 ml Ca2þ e Mg2þ livram Hanks Balanced Solução Salgada (HBSS-CMF, Gibco) completado com 10 heparin de U/ml (Sigma). Depois de fazendo um 1 cm incisão na parede de peritoneal, peritoneal foram colhidos exudates usando um pasteur pipeta e centrifugou a 400 g para 15 min a 4 8C. O número total de celas de peritoneal por peixe era calculado re-suspendendo as celas em 1 ml de Médio de HBSS-CMF e os contando em um haemocytometer.

Uns dois grupos adicionais de cinco pescam (300–500 g) foi injetado com ou 1 ml PBS, ou 1 ml contendo 1 mg Ergosan, e as celas de peritoneal colheram como sobre para quantificar o leucocyte diferente populações (macrofagócito, neutrophils e linfócitos) através de microscopy de elétron de transmissão. Desde então o pesca era aproximadamente quatro-dobra maior que na primeira experiência, estava o volume injetado parente semelhantemente ajustado para a primeira experiência. Pelotas de cela eram durante a noite fixas às 4 8C entre 2.5% glutaraldehyde em 0.15 M PBS a pH 7.4. Preparações foi lavado subseqüentemente para 2 h às 4 8C dentro três mudanças de PBS fresco. Fixação secundária consistiu de colocar as amostras em 1% tetroxide de osmium para 1 h a temperatura de quarto. 2 5 min seguindo lavagens com água destilada, amostras eram desidratadas por umas séries de álcoóis classificados (50- 100% ethanol). óxido de Propylene era usado dentro um secundário passo de desidratação antes de embutir o preparações em Epon (Emscope) resina. Grades eram preparado contendo seções de 60–90 nm e o preparações de cela estavam manchadas com acetato de uranyl e conduz citrato. Foram feitas observações usando um Phillips EM301 elétron microscópio que opera a 60–80 kV. Contas de cela de diferencial foram levadas baixo fora a poder (1900) contando entre 50 e 200 celas. Onde resolução era ampliações difíceis, mais altas era usado onde apropriado. Celas foram identificadas em a base de morfologia e ultrastructure de cela como documentado em leucocyte de peixe prévio estuda (Ellis, 1977; Rowley, 1990,; Afonso al de et., 1997).

2.4. localizou atividade de effects—phagocytic de leucocytes de peritoneal extraído

Dois grupos de pesca (300–500 g) foi injetado com ou 1 ml PBS ou 1 ml que contêm 1 mg Ergosan. Celas de Peritoneal de cada peixe, colheu a 1 postinjection de dia, estava re-suspenso em 1–2 ml de Leibovitz médio (L-15, Gibco) contendo 2% bezerro de foetal soro (FCS, Gibco), heparin (10 ml1 de U) e penicilina (100 ml1)/streptomycin de mg (100 ml1 de U) (P/S, Gibco). foram levadas contas de cela Viáveis fora usar o trypan azulam (Sigma) teste de exclusão, com números finais, ajustado a 1 105 celas por mililitro médio de L-15. Um mililitro da suspensão de cela foi colocado em um metanol limpou deslizamento de copo. Macrophages/neutrophils foi permitido aderir para 1 h dentro um úmido câmara, na escuridão, às 18 8C. Depois de lavar fora celas non-aderentes com HBSS, os deslizamentos foram inundados com 1 ml de suspensão de fermento desnaturada (1:2 108 celas por mililitro pára-choque de medium/phosphate de cultura a uma relação de 1:1). Phagocytosis foi permitido proceder para 1 h na câmara de umidade antes de fermento de excesso foi lavado fora com HBSS e o ar de deslizamentos secados. Fixação de metanol buscaram as preparações de deslizamento manchado consecutivamente com Maio-Grunwald (BDH) e Giemsa mancha. Foram vistos deslizamentos debaixo de imersão de óleo às 1000. Foram contadas aproximadamente 100 celas em campos fortuitos de visão, registrando o número de celas de fermento de phagocytosed e o número de fermento phagocytosed de partículas por cela. Foram expressados dados como S:E mau: phagocytosis de porcentagem e phagocytic índice.

2.5. localizou ensaio de effects—adherence/NBT

Dois grupos de truta (300–500 g) foi injetado intraperitoneally com ou 1 ml de PBS, ou 1 ml 1 mg contendo Ergosan. Foram colhidas celas de Peritoneal a 1 poste-injeção de dia, como sobre. Em ordem para manche a população de neutrophil de peritoneal, um modificou versão do método descrita por Chen et al. (1998) era usado. Brevemente, 100 ml de suspensão de cela estava misturado com 100 ml de tetrazolium de nitroblue (NBT, Sigma) (0.2% w/v em PBS) em um coverslip de copo e subseqüentemente colocado em uma câmara de umidade para 30 min a 18 8C. Celas Non-aderentes eram suavemente afastadas por lavando o coverslip com PBS. O coverslip era virado de cabeça para baixo e colocou em uma gota de PBS em um deslizamento de microscópio. Celas de partidário manchadas azuis eram contado em 10 campos de visão a 400 ampliação.

2.6. localizou expressão de effects—gene

(IL-1b, IL -, TNF-um)

Dois grupos de truta (300–500 g) foi injetado intraperitoneally com ou 1 ml de PBS, ou 1 ml 1 mg contendo Ergosan. Foram colhidas celas de Peritoneal a 1 poste-injeção de dia, como sobre. RNA total estava isolado das pelotas de leucocyte que usam RNAzol B (Biogênese) e subseqüentemente manteve em gelo. Para transcrição inversa, 5 mg de RNAwas recuperaram de ações e re-suspenso em 11 ml de pyrocarbonate de diethyl (DEPC)-tratou água. Livro de leitura de Oligo-dT18 (0.5 mg, Stratagene) foi somado e a mistura de reação incubado às 70 8C para 10 min. Depois de esfriar em gelo, 4 ml (5) de pára-choque de reação, 2 ml de mistura de dNTP (10 mM, Boehringer) e 2 ml de dithiothreitol (0.1 M, Stratagene) foi somado e incubou para 2 min a 42 8C, seguidos por adição de 1 ml de Sobrescrito, MuMLV RNase H transcriptase inverso (50 U, Gibco) e uma 50 incubação de min às 42 8C. A reação foi terminado aquecendo a mistura a 70 8C para 15 min. Foi somada água DEPC-tratada para fazer o volume de reação até 100 ml e o cDNAwas armazenados às 20 8C.

O cDNAwas usaram então para PCR. Condições standards era usado para b-actin, IL-1b e IL-8 PCR usando Taq polymerase de ADN (5 U/ml, Promega). Amplificação foi executado em 50 reações de ml que contêm o componentes seguintes: 1.5 ml remetem e livros de leitura inversos (10 mM cada), 1 dNTP de ml misturam (2.5 mM cada), 5 ml Pára-choque de Taq (10, Promega), 1.5 ml pára-choque de MgCl2 (50 mM, Promega), 36.25 ml H2O estéril e 2 ml de modelo de cDNA. Livros de leitura para b-actin de truta (50-ATCGTGGGGCGCCCCAGGCACC - 30 e 50-CTCCTTAATGTCACGCACGATTTC - 30) era usado como um controle positivo para RT-PCR, desde que o gene é constitutively expresso. Estes livros de leitura foram projetados contra sucessões de b-actin de concensus ampliar um produto de 541 bp dos que atravessaram introns 2 e 3 o gene mamífero, como previamente informou por Zou al de et. (1999). livros de leitura usaram para IL-1b expressão seja IL-1bF10 (50-GGATTCACAAGAACTAAGGAC-30) e IL-1bR3 (50-CTTAGTTGTGGCGCTGGATG-30) (Zou et al., 2000), ainda IL-8F3 (50-GGATGTCAGCCAGCCTTGTC - 30) e IL-8R3 (50-TCCAGACAAA TCCAGACAAATCTCCTGACCG - 30) foi usado para conferir para IL-8 expressão (Laing et al., em imprensa). O protocolo de ciclismo of94 de was1cycle 8Cfor5 ciclos de min,30-35 of94 8Cfor 20 s, 58 8C para 20 s e 72 8C para 20 s, seguiu antes da 1 ciclo de 72 8C para 10 min. PCR condiciona para TNF-um (TNF1 e TNF2) era idêntico a esses previamente descritos, a não ser que 0.2 ml Taq polymerase de ADN, 34.3 ml H2O estéril e 4 ml de modelo de cDNA eram usados. Os livros de leitura usaram era TNF1F1 (50-CAAGAGTTTGAACCTTGTTCAA - 30) e TNF1R1 (50-GCTGCTGCCGCACATAGAC - 30) para TNF1, e TNF2F3 (50-CAAGAGTTTGAACCTCATTCAG - 30) e TNF2R5 (50-GCTGCTGCCGCACATAAAG - 30) para TNF2. O ciclismo protocolo era 1 ciclo de 94 8C para 5 min, 29 ciclos, de 94 8C para 20 s, 60 8C para 20 s e 72 8C para 20 s, seguido por 1 ciclo de 72 8C para 10 min. Produtos de PCR foi visualizado em um 2% gel de agarose que contém ethidium brometo (100 ml1 de ng). Os níveis relativos de RNAwere quantificaram para cada gene por densitometric que esquadrinha de imagens de gel de agarose usando um UVP gel imaging sistema e UVP Gel-works ID avançou software. Relações de product:bactin de cytokine produto foi calculado subseqüentemente para cada gene de interesse e usado avaliar as diferenças dentro expressão nivela entre controle e Ergosan injetou grupos.

2.7. coleção de effects—plasma sistêmica

Cinco grupos de oito pescam (300–500 g) era intraperitoneally injetado com 1 ml de PBS ou 1 ml contendo 1, 5 e 10 mg Ergosan, respectivamente. Ainda anaesthetised, aproximadamente 0.3 ml de periférico foi colecionado sangue por peixe em seringas de heparinized venipuncture seguinte da veia de caudal. Foram obtidas amostras a 0, 2, 5 e 7 postinjection de dias. Foi centrifugado sangue a 400 g para 5 min, o protoplasma colecionou e armazenou às 80 8C até requerido.

2.8. atividade de effects—complement sistêmica

Atividade de complemento clássica em protoplasma de truta era avaliado usando anti-ovelha cela de sangue vermelha (anti-SRBC) soro. Ovelha celas de sangue vermelhas (SRBC, Anticorpo escocês, Unidade de produção) foi centrifugado a 400 g para 10 min, removeram o supernatant, a pelota lavado em PBS e a suspensão re-centrifugadas. Isto lavando passo era quatro vezes repetidas até o supernatant estava claro. A pelota estava re-suspensa dentro Hanks Balanced grátis fenol-vermelho Solução Salgada (HBSS, Gibco) a 3% v/v. foram sensibilizados SRBC para 30 min com calor inactivated truta anti-SRBC soro diluído 1:1000. a 100 ml sensibilizaram SRBC, 100 ml de teste, protoplasma, diluído em HBSS, foi acrescentado bem a uns 96 prato redondo-assentado para dar concentrações finais de 0.5, 1, 2 e 3%. O espaço em branco só conteve HBSS, ainda 100% haemolysis foi alcançado somando água destilada em lugar de uma amostra de protoplasma. Tudo foram incubadas amostras a temperatura de quarto para 1 h então centrifugado a 300 g para 10 min. Para cada bem, 100 ml de supernatant foi transferido ao corresponder bem de um apartamento assentado prato (Nunc) e o absorbance mediram a 405 nm em um spectrophotometer de multiscan. Para calcular o volume de protoplasma necessário causar 50% lysis (unidade de CH50), o 50% OD avaliam (a metade do 100% OD) foi introduzido na curva de diluição de protoplasma contra haemolysis, e o número de unidades de CH50 por mililitro de protoplasma calculado.

2.9. atividade de effects—lysozyme sistêmica

O método descobria atividade de lysozme em truta protoplasma estava baseado na habilidade a lyse o Grama bactéria positiva luteus de Micrococcus. Umas séries de ovo de galinha lysozyme branco (HEWL, Sigma) padrões foram feitos as pazes em 0.1 fosfato de M / pára-choque de citrato (270 ml 0.1 M ácido cítrico, 720 ml 0.1 anhydrous de M hydrophosphate de sódio, 0.9 g cloreto de sódio, pH ajustou a 5.8). O final concentrações construíam a curva standard era 20, 10, 5, 2.5 e 0 lysozyme de mg por mililitro de pára-choque. Uma solução que contém 75 mg de luteus de M. dentro 100 ml de pára-choque foi feito as pazes em cada dia o ensaio foi executado.

Em um apartamento 96 assentaram bem prato, 25 ml de pára-choque, foram dispensadas padrões ou amostras de protoplasma. Em cada bem, 175 ml que M. luteus suspensão foi somada. Depois do prato era abalado, foi colocado imediatamente dentro um spectrophotometer de multiscan fixaram para ler a 450 nm mais de 5 min a 15 intervalos de s (modo de cinética negativo). O lysozyme nivela nas amostras de protoplasma era subseqüentemente calculado do HEWL derivou padrão curva de taxas de Vmax.

2.9.1. atividade de effects—antiprotease sistêmica

O método usado foi projetado para descobrir antiprotease atividade em protoplasma de truta e está baseado no testcombination ensaio para trypsin (Gato de BCL. Não. 125024). Substrate de BAPNA foi feito as pazes dissolvendo 10.4 benzoylarginine-p-nitroaniline de mg (Sigma) em 2 dimethylformamide de ml (DMF, Sigma). O resultante solução foi acrescentada a 20 ml de pára-choque (6.1 g Tris em 100 ml destilaram water.7 g anhydrous cálcio cloreto em 100 ml destilaram água, somaram e ajustaram pH 7.8. volume Total foi composto 250 ml com distilledwater). Atrypsin concentração of100 mg ml1 foi obtido dissolvendo 5 mg de trypsin (Sigma) em 50 ml PBS.

Foram diluídas amostras de protoplasma dois-dobra em PBS dentro redondo-assentado bem 96 pratos (Nunc); protoplasma final volumes de 2.5, 1.25, que foram obtidos 0.625 e 0.313 ml para cada amostra. Em um apartamento-assentou bem 96 prato, 5 ml de foram acrescentadas amostras diluídas a 15 trypsin de ml e foram incubadas para 5 min; duplicatas eram usadas onde bastante protoplasma estava disponível. Finalmente, 200 mlBAPNAsubstrate foram transferidos wasadded para cada well.Theplates então para um spectrophotometer de multiscan fixado para um 15 min cinético corra, enquanto lendo todo 30 s a 405 nm. Para cada amostra de protoplasma, um gráfico de taxas de Vmax (min1 de mOD) contra volume de protoplasma estava plotted e o ‘enfileiram de ' o mais bem ajustado aplicou. A 85% inibição foi calculado valor das amostras em branco. O volume de protoplasma exigido alcançar isto foi calculado da linha de ‘de fórmula o mais bem ajustada ' e o número de unidades de trypsin inibidas por microlitre obtido da curva para cada amostra.

2.9.2. análise de dados

Efeitos localizados eram analysed que usam de mão única ANOVA, twosamplet-testsandMann-WhitneyU-testes como appropriate.With respeitam a efeitos sistêmicos, estatístico, análise de dados envolveu mão dupla e de mão única ANOVAs, seguido pela comparação de pairwise de Tukey, testes.

3. Resultados

3.1. localizou cela de peritoneal de effects—direct conta / contas de leucocyte de diferencial

Ergosanhada clear,dosedependenteffectonthe total número de leucocytes que migra no peritoneal cavidade a 1 poste-injeção de dia (P <0:05, por de mão única ANOVA) (Figo. 1A). Embora a comparação de pairwise de Tukey teste mostrou que concentrações de 0.01 e 0.1 ml1 de mg eram insuficientes para induzir significante migração, Ergosan exibiu um efeito significante a doses 1 ml1 de mg (P <0:05).

O grupo injetou com 1 ml1 de mg que Ergosan exibiu uma significativamente mais baixa proporção de macrofagócito no exudate de peritoneal a 1 poste-injeção de dia, em comparação para o controle pesca (P <0:05, por Mann- WhitneyU-teste) (Figo. 1B). Theproportion de leucocytes identificado como neutrophils era significativamente mais alto dentro o Ergosan injetou grupo (P <0:05). Embora a proporção de leucocytes classificado como linfócitos era baixo parente para as outras duas classificações, havia não uma diferença significante entre os dois grupos.

3.2. localizou atividade de effects—phagocytic de extraiu leucocytes de peritoneal

Uma significativamente maior proporção de leucocytes colhido de peixe injetou intraperitoneally com 1 mg Ergosan em 1 ml PBS exibiu atividade de phagocytic quando exposto a celas de fermento em vitro (P <0:05 por dois t-teste de amostra) (Figo. 2A). Porém, havia nenhum diferença significante entre grupos com respeito a o phagocytic indexam, quer dizer, o número de celas de fermento ingerido por phagocyte (Figo. 2B).

3.3. localizou ensaio de effects—adherence/NBT

O número de NBT celas positivas no peritoneal exudates era mais de 40 vezes maior no 1 mg Ergosan injetou pesca ao invés do grupo de controle (P <0:001, através de dois t-teste de amostra) (Figo. 3).

3.4. localizou expressão de effects—gene

(IL-1b, IL-8, TNF-um) IL-1b, IL-8 e expressão de TNF2 era significativamente maior (P <0:05, através de U-teste de Mann-Whitney) em o grupo injetou com 1 mg suspensão de Ergosan (Figo. 4). Análise por UVP Gel-works ID avançou software revelou que a relação de expressão de gene (relativo para b-actin) para IL-1b, IL-8 e TNF2 tinha 56 anos, 11 e 3 vezes maior respectivamente no Ergosan grupo tratado. Embora expressão de TNF1 era 2 vezes maior no Ergosan injetou grupo, não era significativamente diferente do PBS tratou controle grupo.

3.5. atividade de effects—complement sistêmica

Global, havia um efeito significante de dia (P <0:001) mas não grupo em atividade de complemento, como determinado por ANOVA mão dupla. Uma interação (P <0:001) também foi observado entre estes dois parâmetros. Em dia 2 poste-injeção, havia um significantdifferencebetweengroups (P <0:001)(Fig. 5). As comparações de pairwise de Tukey revelaram que o 1 mg / mlinjectedgroupexhibitedcomplementactivityalmost 300 unidades de CH50 maior que esses documentaram dentro o outro tratamento se agrupa (P <0:05). Depois disso, complemento atividade não voltou a um nível significativamente diferente para os outros três grupos.

3.6. atividade de effects—lysozyme sistêmica

Ergosan não teve nenhum efeito significante em lysozyme de protoplasma

níveis durante o 7-dia período experimental

(Figo. 6). Especificamente, ANOVA mão dupla revelou nenhum

efeito de grupo ou dia, e nenhuma interação entre

esses dois parâmetros.

3.7. atividade de effects—antiprotease sistêmica

Global, havia um efeito significante de grupo (P < 0:05) e dia (P <0:001) em atividade de antiprotease, embora não havia nenhuma interação entre esses parâmetros, como determinado por ANOVA mão dupla. Porém, investigação de cada ponto de tempo revelou nenhum significante diferencie em atividade de antiprotease entre Ergosan grupos tratados, ou entre os grupos de tratamento e o controle (Figo. 7).

4. Discussão

Os documentos de estudo presentes as propriedades de stimulatory de Ergosan, um extrato de algal que contém alginic ácido, em localizou e respostas imunes inatas sistêmicas em truta de arco-íris (mykiss de O.). Complemento, antiprotease e atividade de lysozyme no periférico sangue seja determinado, além de localizado celular efeitos como phagocytosis, redução de NBT e expressão de gene de cytokine.

A resposta de dose de intraperitoneally administrou Ergosan na resposta inflamatória localizada era clareie no estudo presente. Quando administrou a doses de 1 e 5 ml1 de mg, exibiu Ergosan um significante efeito no número total de leucocytes que migra em a cavidade de peritoneal a 1 poste-injeção de dia. Numeroso estudos demonstraram que a injeção de assunto estrangeiro em peixe induz um inflamatório resposta que consiste em migração de leucocyte para o local de injeção (MacArthur et al., 1984; Suzuki, 1986,; Jørgensen et al., 1993). Aquele leucocytes migram depressa para o local de dano é um prelúdio importante para a iniciação de um multifaceted resposta imune (Jørgensen et al., 1993; Pedrera et al., 1993). Embora a dinâmica temporal da resposta inflamatória pode diferir, a resposta por Ergosan é caso contrário qualitatively comparável a isso visto usando outro immunostimulants em peixe, como glucan de fermento, (Jørgensen et al., 1993), glycogen (MacArthur et al., 1984; Jørgensen et al., 1993), Freund está Incompleto Adjuvant (FIA) (o Adams al de et., 1988; Jørgensen et al., 1993) e o Adjuvant Completo de Freund (FCA) (o Finn e Neilson, 1971). mais importantemente, Fujiki e Yano (1997) observou uma afluência de leucocytes no cavidade de peritoneal de carpa injetou com 2 mg 100 g weight1 de corpo alginate de sódio, semelhante para o ótimo doses de Ergosan acharam no estudo presente, com o peaking de resposta 2 poste-injeção de dias.

A composição global de leucocytes no peritoneal exudates também foi alterado significativamente como um conseqüência de administração de Ergosan, com neutrophils, sendo aumentado e macrofagócito diminuíram. A 2 poste-injeção de dias, Jørgensen et al. (1993) observou uma resposta semelhante na cavidade de peritoneal de Atlântico salmão (salar de Salmo) injetou com FIA e glycogen. Porém, Ergosan difere de b-glucan de fermento, como o administração de intraperitoneal do posterior estimula uma afluência de macrofagócito (Jørgensen et al., 1993). Embora o papel do neutrophils em inflamação é ainda um tópico de debate (Dalmo et al., 1997), é provável que eles são um jogador principal em phagocytic e respiratório estouro mediou atividade bactericida (as Lamas e Ellis, 1994,; Furgão de Verburg Kemenade et al., 1994). Tipicamente, na cavidade de peritoneal de unstimulated de Mykiss de O., neutrophils são relativamente incomuns, com macrofagócito a população de leucocyte predominante presente (o Afonso al de et., 1997). O processo de phagocytic é um mecanismo importante para a destruição de pathogens bacteriano extra-celular, ambos em mamíferos e em pesca (Pedrera et al., 1993). no estudo presente, um significativamente maior proporção de leucocytes extraído, colhida de peixe, injetado com 1 mg Ergosan, phagocytic exibido, atividade quando exposto a celas de fermento em vitro. Porém, o índice de phagocytic era não afetado por administração de Ergosan.

Em um estudo semelhante, Fujiki e Yano (1997) observado um aumento na atividade de phagocytic de celas de peritoneal, administração seguinte de sódio, alginate (2 mg 100 g corpo weight1) censurar. Assim, Ergosan pode ser acrescentado à lista de immunostimulants isso modula atividade de phagocyte de peixe quando administrou intraperitoneally que inclui levamisole (Siwicki, 1987,; Kajita et al., 1992), FK-565 (Kitao e Yoshida, 1986), MDP (Kodama et al., 1993), ELEPÊS (Salati et al., 1987), FCA (o Olivier al de et., 1986), chitin (Sakai et al., 1992), b-glucan de fermento (Chen e Ainsworth, 1992) e lentinan (Yano et al., 1989).

MgErgosanresulted de Intraperitonealadministrationof1 em um aumento de 40-dobra no número de positivo de NBT celas na cavidade de peritoneal a 1 poste-injeção de dia. Assim, Ergosan por algum como ainda uncharacterised mecanismo, pode ativar neutrophils que provoca isto aumentou atividade (o Anderson al de et., 1992). NBT redução é tipicamente associada com estouro respiratório atividade, caracterizada por localisation de intracellular de, o anionte de superoxide em phagocytes (Dalmo et al., 1997). outro immunostimulants como b-glucan de fermento (O Anderson al de et., 1992; Jeney e Anderson, 1993), scleroglucan, zymosan e uma gama de outro polysaccharides (Wang e Wang, 1997) também module o número de NBT celas positivas em uma gama de pesque espécies.

Este estudo provê o primeiro informação interessando Ergosan induziu expressão de cytokine (IL-1b, IL-8, TNF-um) genes no leucocytes de peritoneal extraído de truta de arco-íris. Já é conhecido que IL-1b e TNF-uma expressão é para cima-regulada em truta rim de cabeça leucocytes ou macrofagócito expuseram a ELEPÊS (Zou et al., 2000; Laing et al., 2001) e IL-1b isto (Hong et al., 2001; Laing et al., 2001). Assim, Ergosan pode ser agora acrescentado à lista de substâncias que estimulam o expressão deste cytokines importante. É particularmente interessante que foi o segundo isoform de truta TNF-um (TNF2) isso era afetado por Ergosan tratamento. Estudos prévios que olham para indução de expressão por ELEPÊS achados aquele TNF2 era o dominante cópia (Zou et al., 2002). Se diferenças em atividade biológica das proteínas codificadas existe restos ser determinado. Aquele Ergosan também pôde aumente IL-8 expressão em vivo é particularmente pertinente para a discussão de atração de neutrophil e ativação, e pontos para um possível mecanismo de ação pela qual este immunostimulant age. Do humoral mediram parâmetros imunes, atividade de complemento clássica em sangue era significativamente aumentado 2 poste-injeção de dias no 1 mg Ergosan tratou grupo. Nenhum efeito era evidente a mais alto doses (5 e 10 mg), ou a qualquer hora aponte depois disso. Em contraste, Fujiki e Yano (1997) não ache impacto de alginate de sódio em atividade de complemento de carpa. Ainda isto poderia indicar uma truta fenômeno específico, alginates podem estimular só complemento em cima de um gama de dose estreita, como insinuado pelo jogo de dados atual. Muitos outro immunostimulants podem aumentar complemento atividade administração de intraperitoneal seguinte, como com levamisole (Kajita et al., 1992), b-glucan de fermento (Engstad et al., 1992; Lunde e Robertsen, 1997) e schizophyllan (Matsuyama et al., 1992), embora cada possui cinética temporal diferente.

Embora b-glucans de fermento (Jørgensen et al., 1993; Thompson al de et., 1995) e schizophyllan (Matsuyama al de et., 1992) também tenha a habilidade para aumentar lysozyme atividade em vivo, Ergosan não estava usando nenhum efeito significante este parâmetro específico durante o 7-dia experimental balança de tempo. Semelhantemente, comparações de intergroup em cada dia de provar durante a balança de tempo experimental não revelado nenhuma diferença significante em antiprotease de protoplasma atividade. Embora vários estudos investigaram antiprotease nivela em espécies de peixe, particularmente, atividade de a2-macroglobulin (Liberto, 1991,; Salte al de et., 1993; Bowden et al., 1997), datar há pequeno informação relativo a modulação em peixe diferente de através de infecção.

Em conclusão, a propriedade de immunostimulatory de intraperitoneally injetaram Ergosan foi demonstrado em truta de arco-íris. Migração de leucocytes em a cavidade de peritoneal foi estimulada a doses 1 mg ml1. Além disso, uma dose de 1 mg que Ergosan aumentou ativação de neutrophil/macrophage, como comprovado por aumentos em phagocytosis, redução de NBT e cytokine expressão de gene, pelo menos no a curto prazo. O parâmetros de humoral estudados eram menos responsivos para Administração de Ergosan, com só atividade de complemento, sendo elevado, também a tempos cedo (2 dias) postinjection. Estudo adicional dos mecanismos por qual Ergosan induz estes efeitos e se isto conduz de resistência de doença aumentada em vivo é precisada. Reconhecimentos Este trabalho foi apoiado por um BBSRC Industrial EMBALE studentship a SP (com Vacinas de Aquaculture Limitado). Obrigado vá para Dr. P.D. o Smith (AVL) para provendo o Ergosan e para Sr. K. McKenzie (Departamento de Zoologia, Universidade de Aberdeen) para ajuda com miscroscopy de elétron.

Comentários